hdac3  (Santa Cruz Biotechnology)

Journal: bioRxiv

Article Title: Lysine deacetylation inhibition reverses TDP-43 mislocalization and in combination with arimoclomol ameliorates neuromuscular pathology

doi: 10.1101/2024.12.15.628528

Figure Lengend Snippet: Cytoplasmic (Cyt.) levels of TDP-43 ( A ) and TDP-35CTF ( B ) in control (Ctrl; n ≥ 6) and serum-deprived HEK293 cells (Starvation), untreated (Untr; n ≥ 6) or treated with 1 μM HDACi (n=3-6): SAHA, RGF109, RGFP966, ACY-738, tubastatin A (tubA) and selisistat. Dashed line indicates Ctrl level. ( C ) PPIAK125ac levels in total lysate of control (Ctrl; n=5) and serum-deprived HEK293 cells (Starvation), untreated (Untr; n=5) or treated with 1 μM SAHA (n=6). ( D ) PPIAK125ac levels in total lysate of HEK293 transiently transfected with siRNA control (Scramble; n=3), siRNA for HDAC1 (n=4) and HDAC3 (n=4). ( A-D ) Data (mean ± SEM) indicate WB immunoreactivity normalized to total protein loading ( A-D ) and to PPIA levels ( C-D ). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 by one-way ANOVA, Dunnett’s multiple comparisons ( A-B ), Uncorrected Fisher’s LSD ( C ) or Tukey’s multiple comparisons ( D ) post-hoc tests.

Article Snippet: Complexes were prepared in 24-wells plate by diluting 6 pmol of siRNA for HDAC1 (5’-UGG CCA UCC UGG AAC UGC UAA AGU A-3’; ID: HSS104726; Invitrogen) or siRNA for HDAC3 (5’-CAA GGA AAG CGA UGU GGA GAU UUA A-3’; ID: HSS189614; Invitrogen) or scrambled siRNA (Stealth™ RNAi Negative Control Duplex #12935-113; Invitrogen) in Opti-MEM™ I Reduced Serum Medium (Gibco) with Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen).

Techniques: Control, Transfection

Journal: bioRxiv

Article Title: Lysine deacetylation inhibition reverses TDP-43 mislocalization and in combination with arimoclomol ameliorates neuromuscular pathology

doi: 10.1101/2024.12.15.628528

Figure Lengend Snippet: ( A-O ) RT-PCR for Hdac1 , Hdac2 , Hdac3 , Hdac4 and Hdac6 in spinal cord of Thy1-hTDP-43 mice treated with SAHA or vehicle and analysed at disease onset (n=4-5 in each experimental group) ( A-E ), at symptomatic stage (n=5-6 in each experimental group) ( F-J ) or treated with SAHA+Arim. combination and analysed at symptomatic stage (n=5 in each experimental group) ( K-O ). Data (mean ± SEM) are normalized to β-actin and expressed as relative mRNA expression. *p < 0.05, **p < 0.01 by Student’s t test.

Article Snippet: Complexes were prepared in 24-wells plate by diluting 6 pmol of siRNA for HDAC1 (5’-UGG CCA UCC UGG AAC UGC UAA AGU A-3’; ID: HSS104726; Invitrogen) or siRNA for HDAC3 (5’-CAA GGA AAG CGA UGU GGA GAU UUA A-3’; ID: HSS189614; Invitrogen) or scrambled siRNA (Stealth™ RNAi Negative Control Duplex #12935-113; Invitrogen) in Opti-MEM™ I Reduced Serum Medium (Gibco) with Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing

Journal: Cell Death Discovery

Article Title: HDAC3 genetic and pharmacologic inhibition radiosensitizes fusion positive rhabdomyosarcoma by promoting DNA double-strand breaks

doi: 10.1038/s41420-024-02115-y

Figure Lengend Snippet: A Biochemical data of MC4448 against HDAC1, −3, −4, −6 and −8 at three fixed doses (0.01, 0.3, and 7 µM). B Dose-response curves of RH30 and RH4 cells treated with increasing concentration of MC4448. Graph represents the mean of three independent experiment ±SEM. C Representative western blot ( n = 3) of RH30 and RH4 treated with MC4448 IC50 for 24 h showing levels of acetylated H3. Vinculin was used as loading control. D Growth curve analysis of RH30 and RH4 cells treated as in ( C ). n = 3 independent experiments, data presented as mean values ± SD, Student’s two-tailed t test. E Heatmap depicting dose response effect of MC4448 treatment for 72 h on FP-RMS cells (RH30 and RH4), and Normal Human Skeletal Muscle Myoblast (HSMM) and Normal Fetal Human Lung Fibroblast (MRC5).

Article Snippet: RNA interference was performed with 100 nM final concentration siRNAs against human HDAC1 (GCCGGUCAUGUCCAAAGUAAU), HDAC2 (GUUGCUCGAUGUUGGACAUAU), HDAC3 (CCUGCAUUACGGUCUCUAUAA), HDAC8 (UUACGAUUGCGACGGAAAUUU) or with a non-targeting siRNA as control (SIC001) (Sigma-Aldrich, St Louis, MO, USA) using Oligofectamine (Invitrogen, Carlsbad, CA).

Techniques: Concentration Assay, Western Blot, Control, Two Tailed Test